There are two known types of genes encoding GAR transformylase in Escherichia coli: purN and purT, while only purN is found in humans. [8] Many residues in the active site are conserved across bacterial, yeast, avian and human enzymes. Purine metabolism is involved in S.

Understanding the Context

aureus persister formation, and purN, encoding phosphoribosylglycinamide formyltransferase, is an important gene in the purine metabolism process. In this study, we generated a Δ purN mutant of the S. aureus Newman strain and assessed its roles in antibiotic tolerance and virulence. Gene target information for PURN.

Key Insights

Find diseases associated with this biological target and compounds tested against it in bioassay experiments. 5'-Phosphoribosylglycinamide transformylase (EC 2.1.2.2), encoded by the purN gene of Escherichia coli, catalyzes the synthesis of 5'-phosphoribosylformylglycinamide from 5'-phosphoribosylglycinamide (GAR) [1]. BKE06510 ([gene|7B30F27D6C459437967A64467E52961F4A9E0F2C|purN]::erm trpC2) available at [http://bgsc.org/getdetail.php?bgscid=BKE06510 BGSC], [Pubmed|28189581], upstream reverse: _UP1_TGATGCAAATACCGCAAACT, downstream forward: _UP4_TTAAATAACAGAGGTGAAAA Purine metabolism is involved in S. aureus persister formation, and purN, encoding phosphoribosylglycinamide formyltransferase, is an important gene in the purine metabolism process. The PurN protein consists of two subdomains, an N-terminal subdomain (coloured green and labelled N) and a C-terminal subdomain (coloured red and labelled C).

Final Thoughts

Residue numbers appropriate to each protein are shown above the bar diagrams. Structure of the phosphoribosylglycinamide formyltransferase (purN) in complex with CHES from Coxiella burnetii